How can I force a long string without any blank to be wrapped?

Question

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

Solution 1

for block elements:

<textarea style="width:100px; word-wrap:break-word;">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> 
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</span>

Solution 2

Place zero-width spaces at the points where you want to allow breaks. The zero-width space is ​ in HTML. For example:

ACTGATCG​AGCTGAAG​CGCAGTGC​GATGCTTC​GATGATGC

Solution 3

Here are some very useful answers:

How to prevent long words from breaking my div?

to save you time, this can be solved with css:

white-space: -moz-pre-wrap; /* Mozilla */
white-space: -hp-pre-wrap; /* HP printers */
white-space: -o-pre-wrap; /* Opera 7 */
white-space: -pre-wrap; /* Opera 4-6 */
white-space: pre-wrap; /* CSS 2.1 */
white-space: pre-line; /* CSS 3 (and 2.1 as well, actually) */
word-wrap: break-word; /* IE */
word-break: break-all;

Solution 4

For me this works,

<td width="170px" style="word-wrap:break-word;">
  <div style="width:140px;overflow:auto">
    LONGTEXTGOESHERELONGDIVGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESLONGTEXTGOESHERELONGDIVLONGTEXTLONGTEXT
  </div>
</td>

You can also use a div inside another div instead of td. I used overflow:auto, as it shows all the text both in my Opera and IE browsers.

Solution 5

I don't think you can do this with CSS. Instead, at regular 'word lengths' along the string, insert an HTML soft-hyphen:

ACTGATCG­AGCTGAAG­CGCAGTGC­GATGCTTC­GATGATGC­TGACGATG

This will display a hyphen at the end of the line, where it wraps, which may or may not be what you want.

Note Safari seems to wrap the long string in a <textarea> anyway, unlike Firefox.

View more solutions

Comments

[splattne]

Ironically the string doesn't break in Stack Overflow either...

[Daniel Schaffer]

Wow, didn't even know about that. Neat!

[Adam Bellaire]

It's supported only in IE, Safari, and FF3.1 (alpha).

[LabRat01010]

just tested your solution with the last FF . Worked fine.

[Farinha]

Thanks for this solution. Was having a hard time getting something like this to work inside a table, and this solution is the only one that I found works in IE, Firefox and Chrome.

[montrealist]

+1, this works better as it covers more cases, even though question was for a more particular case.

[MV.]

You can mix this solution with Remy's solution to insert zero-width spaces: wordwrap ($longtext, 5, "​", true);

[Asgher]

this works only in new wave of browsers - see caniuse.com/#search=word-break

[Graeck]

Yes, the #3 there works in all modern browsers and even older IE6+.

[justisb]

You could alternatively use the <wbr> tag, which serves the same purpose of providing an optional line-break opportunity.

[TechBrush.Org]

It is a complete and easy answer i think that guy who posted this problem originally should use width:100%; with float:left; on element which contains that string and his problem will be resolved. then why is this answer not relevant?

[LabRat01010]

because that guy who posted this problem don't think your solution worked five years ago.

[TechBrush.Org]

Yes, but this forum is not only about that guy only its about this forum and other people facing similar problem like me today can also have benefit from the same.

[Robusto]

@Michael: The answer uses the "word-wrap" rule, not the "word-break" one; the former is supported as used in almost every browser used today. Where "partial support" is indicated, it appears that the "break-word" value for the "word-wrap" rule is still viable.

[Nick Benedict]

+1 this because it mentions word-break:break-all; which worked for me in IE9

[user3167101]

Watch if you do this in things that might be copied and pasted.

[Matt Smith]

I don't think this solution works any longer. At least not in current Chrome.

[Ciro Santilli OurBigBook.com]

The property got renamed to overflow-wrap since in the standards, but wrod-wrap is widely implemented.

[danigonlinea]

This did not work for me. I have to move "word-wrap" property into div and remove "overflow" property. With this changes, works.

[Stan]

word-break: break-all; was the only one that worked in Android WebView for me.

[Karl]

I did not know about that either. Double Neat!

[Neal Ehardt]

Regex \s (whitespace), doesn't match a zero-width space. If you want to remove them, you need to explicitly write /\u200B/g or similar. See developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/…

[collapsar]

#3 only works if there are opportunities to break by words. An overly long string does not break ( tested on Chrome 52.0.2743.82 ).

[David R Tribble]

Note: Some of us prefer to spell it in hex, as ​, so that we can find the Unicode reference (code U+200B) more easily.

[Green]

It doesn't work. It breaks words in the middle of the word.

[César León]

Also works with "display: table-cell", was necesary in my case

[tbrlpld]

In case a predefined width is not desired, using <span style="overflow-x:hidden; word-wrap:break-word;"> works too. (Firefox 58)

[Yevgen Fesenko]

This is very useful for wrapping inside HTML emails (if you are able to process text before rendering templates) without the headache of worrying about rendering logic in different email clients

[Lonnie Best]

Thank you for word-break: break-all;!

[Matt]

I needed word-break: break-all for this as mentioned in emiks answer

[i336_]

TIL there's a -hp- prefix!

[cyclingLinguist]

I needed overflow-wrap: 'anywhere'

[aequalsb]

now... the most relevant comments all refer to overflow-wrap... i upvoted each comment to try an draw more attention to them... overflow-wrap:anywhere did it for me